Works matching IS 17515521 AND DT 2017 AND VI 39

Results: 154

Comparing the performance of three panels rules of blood smear review criteria on an Italian multicenter evaluation.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 645, doi. 10.1111/ijlh.12720

By:

Pipitone, S.;
Germagnoli, L.;
Da Rin, G.;
Di Fabio, A.;
Fanelli, A.;
Fiorini, F.;
Francione, S.;
Marini, A.;
Papa, A.;
Benegiamo, A.;
Lari, T.;
Siviero, F.;
Lorubbio, M.;
Borin, M.;
Seghezzi, M.;
Ciardelli, M. L.;
Dima, F.;
Gioia, M.;
Buoro, S.

Publication type:

Article

Potential misdiagnosis of dysfibrinogenaemia: Data from multicentre studies amongst UK NEQAS and PRO-RBDD project laboratories.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 653, doi. 10.1111/ijlh.12721

By:

Jennings, I.;
Kitchen, S.;
Menegatti, M.;
Palla, R.;
Walker, I.;
Peyvandi, F.;
Makris, M.

Publication type:

Article

Performance evaluation of the automated nucleated red blood cell count of five commercial hematological analyzers.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 663, doi. 10.1111/ijlh.12722

By:

Da Rin, G.;
Vidali, M.;
Balboni, F.;
Benegiamo, A.;
Borin, M.;
Ciardelli, M. L.;
Dima, F.;
Di Fabio, A.;
Fanelli, A.;
Fiorini, F.;
Francione, S.;
Germagnoli, L.;
Gioia, M.;
Lari, T.;
Lorubbio, M.;
Marini, A.;
Papa, A.;
Seghezzi, M.;
Solarino, L.;
Pipitone, S.

Publication type:

Article

Clot waveform analysis: Where do we stand in 2017?

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 561, doi. 10.1111/ijlh.12724

By:

Sevenet, P. O.;
Depasse, F.

Publication type:

Article

In vitro variations of Mean platelet volume over time in blood samples collected in different anticoagulants from thrombocytopenic patients and healthy subjects.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. e151, doi. 10.1111/ijlh.12745

By:

Podda, G. M.;
Casazza, G.;
Soru, P.;
Scavone, M.;
Vismara, G.;
Cattaneo, M.

Publication type:

Article

Performance evaluation of the Spinit®- BC, a new point-of-care assay for total WBC count with 5-part differential and hematocrit measurement.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. e155, doi. 10.1111/ijlh.12747

By:

Graindor, N.;
Blomme, S.;
Jughmans, S.;
Boeckx, N.;
Kieffer, D.

Publication type:

Article

IgG subclasses of FVIII inhibitors in an argentine cohort of severe hemophilia A patients: Analysis by flow cytometry.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 569, doi. 10.1111/ijlh.12696

By:

Irigoyen, M. B.;
Primiani, L.;
Felippo, M.;
Candela, M.;
Bracco, M. M. E.;
Galassi, N. V.

Publication type:

Article

Global assays of fibrinolysis.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. e140, doi. 10.1111/ijlh.12710

By:

Lisman, Ton

Publication type:

Article

The clinical significance of monitoring the expression of the SIL- TAL1 fusion gene in T-cell acute lymphoblastic leukemia after allogeneic hematopoietic stem cell transplantation.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 613, doi. 10.1111/ijlh.12711

By:

Zhao, X.;
Hong, Y.;
Qin, Y.;
Xu, Y.;
Chang, Y.;
Wang, Y.;
Zhang, X.;
Xu, L.;
Huang, X.

Publication type:

Article

Duffy null genotype or Fy(a-b-) phenotype are more accurate than self-declared race for diagnosing benign ethnic neutropenia in Brazilian population.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. e144, doi. 10.1111/ijlh.12712

By:

Dinardo, C.L.;
Kerbauy, M.N.;
Santos, T.C.;
Lima, W.M.;
Dezan, M.R.;
Oliveira, V.B.;
Mendrone‐Júnior, A.;
Rocha, V.;
Velloso, E.D.R.P.

Publication type:

Article

Diagnostic and prognostic value of low percentage of glycosylated ferritin in acquired hemophagocytic lymphohistiocytosis: A single-center study.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 620, doi. 10.1111/ijlh.12713

By:

Nabergoj, M.;
Marinova, M.;
Binotto, G.;
Brugnaro, L.;
Zaninotto, M.;
Plebani, M.;
Semenzato, G.;
Vianello, F.

Publication type:

Article

CD66c ( KOR- SA3544) antigen expression of leukemic blasts in pediatric acute myeloid leukemia with TLS/ FUS- ERG fusion transcript.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. e147, doi. 10.1111/ijlh.12714

By:

Kobayashi, K.;
Isobe, K.;
Hanada, R.;
Kawaguchi, H.;
Iwata, T.;
Kawamura, M.

Publication type:

Article

Immunophenotypic aberrancies in acute lymphoblastic leukemia from 282 Iraqi patients.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 625, doi. 10.1111/ijlh.12716

By:

Jalal, S. D.;
Al‐Allawi, N. A. S.;
Al Doski, A. A. S.

Publication type:

Article

Comparison of performance and abnormal cell flagging of two automated hematology analyzers: Sysmex XN 3000 and Beckman Coulter DxH 800.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 633, doi. 10.1111/ijlh.12717

By:

Genc, S.;
Dervisoglu, E.;
Erdem, S.;
Arslan, O.;
Aktan, M.;
Omer, B.

Publication type:

Article

Influences of argatroban on five fibrinogen assays.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 641, doi. 10.1111/ijlh.12719

By:

Zhang, L.;
Yang, J.;
Zheng, X.;
Fan, Q.;
Zhang, Z.

Publication type:

Article

Issue Information.

Published in:: International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 557, doi. 10.1111/ijlh.12591
Publication type:: Article

Global assays of fibrinolysis.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. e142, doi. 10.1111/ijlh.12750

By:

Ilich, A.;
Key, N. S.

Publication type:

Article

List of Reviewers.

Published in:: 2017
Publication type:: Other

A single-tube flow cytometric procedure for enhancing the diagnosis and prognostic classification of patients with myelodysplastic syndromes.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 577, doi. 10.1111/ijlh.12700

By:

Kárai, B.;
Bedekovics, J.;
Miltényi, Zs.;
Gergely, L.;
Szerafin, L.;
Ujfalusi, A.;
Kappelmayer, J.;
Hevessy, Zs.

Publication type:

Article

Evaluation of the Sysmex XN-550, a Novel Compact Haematology analyser from the XN-L® series, compared to the XN-20 system.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 585, doi. 10.1111/ijlh.12701

By:

Tailor, H.;
Mackie, I.;
Mellick, A.;
Machin, S.

Publication type:

Article

Thrombophilic gene polymorphisms and recurrent pregnancy loss in Greek women.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 590, doi. 10.1111/ijlh.12703

By:

Chatzidimitriou, M.;
Chatzidimitriou, D.;
Mavridou, M.;
Anetakis, C.;
Chatzopoulou, F.;
Lialiaris, T.;
Mitka, S.

Publication type:

Article

Multicenter verification of the Sysmex XN-Series.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 489, doi. 10.1111/ijlh.12674

By:

Schoorl, M.;
Chevallier, M.;
Ploeg, T.;
Pelt, J.

Publication type:

Article

ICSH recommendations for modified and alternate methods measuring the erythrocyte sedimentation rate.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 448, doi. 10.1111/ijlh.12693

By:

Kratz, A.;
Plebani, M.;
Peng, M.;
Lee, Y.K.;
McCafferty, R.;
Machin, S.J.

Publication type:

Article

Relationship between red blood cell distribution width, bilirubin, and clinical characteristics of patients with gastric cancer.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 497, doi. 10.1111/ijlh.12675

By:

Wei, T.‐T.;
Wang, L.‐L.;
Yin, J.‐R.;
Liu, Y.‐T.;
Qin, B.‐D.;
Li, J.‐Y.;
Yin, X.;
Zhou, L.;
Zhong, R.‐Q.

Publication type:

Article

Cryohemolysis test is for what's causing the spherocytosis.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. e135, doi. 10.1111/ijlh.12707

By:

Abdulsalam, A. H.;
Ghiath, Y.

Publication type:

Article

Assessment of semi-quantitative grading of red blood cell abnormalities utilizing images from the CellaVision DM96 compared to manual light microscopy.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e110, doi. 10.1111/ijlh.12673

By:

Nakashima, M. O.;
Doyle, T. J.;
Phelan‐Lewin, K.;
Summers, J. M.;
Bena, J.;
Hsi, E. D.

Publication type:

Article

Reticulocyte count and extended reticulocyte parameters by Mindray BC-6800: Reference intervals and comparison with Sysmex XE-5000.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 596, doi. 10.1111/ijlh.12705

By:

Buttarello, M.;
Rauli, A.;
Mezzapelle, G.

Publication type:

Article

Targeted next-generation sequencing using a multigene panel in myeloid neoplasms: Implementation in clinical diagnostics.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. 604, doi. 10.1111/ijlh.12709

By:

Maes, B.;
Willemse, J.;
Broekmans, A.;
Smets, R.;
Cruys, B.;
Put, N.;
Madoe, V.;
Janssen, M.;
Soepenberg, O.;
Bries, G.;
Vrelust, I.;
Achten, R.;
Van Pelt, K.;
Buvé, K.;
Theunissen, K.;
Peeters, V.;
Froyen, G.

Publication type:

Article

A novel single nucleotide deletion mutation in exon 2 ( HBB: c240delC) of beta globin gene: A case report.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 6, p. e137, doi. 10.1111/ijlh.12708

By:

Tripathi, P.;
Muthuswamy, S.;
Agarwal, S.

Publication type:

Article

Co-inheritance of α0-thalassemia elevates Hb A2 level in homozygous Hb E: Diagnostic implications.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 508, doi. 10.1111/ijlh.12677

By:

Singha, K.;
Srivorakun, H.;
Fucharoen, G.;
Fucharoen, S.

Publication type:

Article

Diagnosis and molecular characterization of a novel α0-thalassemia deletion (- Kozani) found in a Greek child with unexplained microcytic hypochromic anemia.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e124, doi. 10.1111/ijlh.12690

By:

Makis, A.;
Georgiou, I.;
Traeger‐Synodinos, J.;
Chaliasos, N.;
Grosso, M.;
Gambale, A.;
Iolascon, A.

Publication type:

Article

A performance evaluation of a novel human recombinant tissue factor prothrombin time reagent (Revohem™ PT).

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 532, doi. 10.1111/ijlh.12691

By:

Gardiner, C.;
Kohama, K.;
Patel, I.;
Lane, P.;
Dwyer, S.;
Machin, S. J.;
Mackie, I. J.

Publication type:

Article

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 539, doi. 10.1111/ijlh.12692

By:

Rizo‐de‐la‐Torre, L. C.;
Ibarra, B.;
Sánchez‐López, J. Y.;
Magaña‐Torres, M. T.;
Rentería‐López, V. M.;
Perea‐Díaz, F. J.

Publication type:

Article

The evaluation of the relevance of thrombin generation and procoagulant activity in thrombotic risk assessment in BCR- ABL-negative myeloproliferative neoplasm patients.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 502, doi. 10.1111/ijlh.12676

By:

Baccouche, H.;
Ben Jemaa, M.;
Chakroun, A.;
Chadi, S.;
Mahjoub, S.;
Sfar, I.;
Gorgi, Y.;
Ben Romdhane, N.

Publication type:

Article

Higher rate of central nervous system involvement by flow cytometry than morphology in acute lymphoblastic leukemia.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 546, doi. 10.1111/ijlh.12694

By:

Dass, J.;
Dayama, A.;
Mishra, P. C.;
Mahapatra, M.;
Seth, T.;
Tyagi, S.;
Pati, H. P.;
Saxena, R.

Publication type:

Article

CD11c expression in chronic lymphocytic leukemia revisited, related with complications and survival.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 552, doi. 10.1111/ijlh.12695

By:

Umit, E. G.;
Baysal, M.;
Durmus, Y.;
Demir, A. M.

Publication type:

Article

Evaluation of whole-blood conservation reagents for Hematoflow-based WBC differential count: Unsatisfactory results.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e127, doi. 10.1111/ijlh.12697

By:

Wagner‐Ballon, O.;
Badaoui, B.;
Brignoli, A.;
Le Priol, J.;
Roussel, M.

Publication type:

Article

Issue Information.

Published in:: International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 439, doi. 10.1111/ijlh.12590
Publication type:: Article

Impact of different storage times at room temperature of unspun citrated blood samples on routine coagulation tests results. Results of a bicenter study and review of the literature.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 458, doi. 10.1111/ijlh.12660

By:

Toulon, P.;
Metge, S.;
Hangard, M.;
Zwahlen, S.;
Piaulenne, S.;
Besson, V.

Publication type:

Article

The frequency of occurrence of atypical lymphocytes in peripheral blood smears of natalizumab-treated patients with multiple sclerosis.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 469, doi. 10.1111/ijlh.12662

By:

Robier, C.;
Amouzadeh‐Ghadikolai, O.;
Bregant, C.;
Diez, J.;
Melinz, K.;
Quehenberger, F.;
Quasthoff, S.

Publication type:

Article

Frequency of polycythemia in individuals with normal complete blood cell counts according to the new 2016 WHO classification of myeloid neoplasms.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 528, doi. 10.1111/ijlh.12686

By:

Sandes, A. F.;
Gonçalves, M. V.;
Chauffaille, M. de L.

Publication type:

Article

Is it acceptable to use coagulation plasma samples stored at room temperature and 4°C for 24 hours for additional prothrombin time, activated partial thromboplastin time, fibrinogen, antithrombin, and D-dimer testing?

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 475, doi. 10.1111/ijlh.12664

By:

Rimac, V.;
Coen Herak, D.

Publication type:

Article

Critical values in hematology of 862 institutions in China.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 513, doi. 10.1111/ijlh.12681

By:

Ye, Y.Y.;
Zhao, H.J.;
Fei, Y.;
Wang, W.;
He, F.L.;
Zhong, K.;
Yuan, S.;
Wang, Z.G.

Publication type:

Article

Adopting automated image analysis tool for fibrin network: Can we obtain clot properties for practical application?

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e121, doi. 10.1111/ijlh.12689

By:

Yoon, J. G.;
Song, J.

Publication type:

Article

Evaluation of OSMOCELLS, a new semi-automatic device for osmotic fragility assessment.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 521, doi. 10.1111/ijlh.12683

By:

Gérard, D.;
Fattet, A‐J.;
Brakta, C.;
Phulpin, A.;
Steschenko, D.;
Lesesve, J‐F.;
Perrin, J.

Publication type:

Article

Profound spherocytosis in adulthood: Acquired, hereditary or both?

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e117, doi. 10.1111/ijlh.12685

By:

Langeveld, T. J. C.;
Rossum, A. P.;
Zwaag, B.;
Wijk, R.;
Vlasveld, L. Th.

Publication type:

Article

A comparative study using thrombin generation and three different INR methods in patients on Vitamin K antagonist treatment.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 482, doi. 10.1111/ijlh.12668

By:

Riva, N.;
Vella, K.;
Meli, S.;
Hickey, K.;
Zammit, D.;
Calamatta, C.;
Makris, M.;
Kitchen, S.;
Ageno, W.;
Gatt, A.

Publication type:

Article

Global assays of fibrinolysis.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 441, doi. 10.1111/ijlh.12688

By:

Ilich, A.;
Bokarev, I.;
Key, N. S.

Publication type:

Article

Assessing the stability and suitability of haematology parameters for diagnosing and monitoring iron deficiency.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e132, doi. 10.1111/ijlh.12702

By:

Sellors, A.;
Melbourne, J.;
Barratt, J.;
Barton, L.

Publication type:

Article

Relevance of ethnic differences in factor XIII activity on laboratory reference ranges.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e113, doi. 10.1111/ijlh.12684

By:

Wong, W. H.;
Tan, C. K.;
Ho, L. P.;
Tan, C. W.;
Kaur, H.;
Lee, L. H.;
Ng, H. J.

Publication type:

Article