Works by de la Torre, C.
Results: 163
Cefpodoxime proxetil suspension compared with cefaclor suspension for treatment of acute otitis media in paediatric patients.
- Published in:
- 1996
- By:
- Publication type:
- journal article
Persistence of Lassa Virus Associated With Severe Systemic Arteritis in Convalescing Guinea Pigs (Cavia porcellus).
- Published in:
- 2019
- By:
- Publication type:
- journal article
Extending the Antiviral Value of Favipiravir.
- Published in:
- 2018
- By:
- Publication type:
- Editorial
Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.
- Published in:
- 2022
- By:
- Publication type:
- journal article
Design of New Bis(1,2,3‐triazol‐1‐yl)methane‐Based Nitrogen Ligands: Synthesis and Coordination Chemistry.
- Published in:
- Chemistry - A European Journal, 2024, v. 30, n. 29, p. 1, doi. 10.1002/chem.202304291
- By:
- Publication type:
- Article
Humoral Immune Response Induced by the BBIBP-CorV Vaccine (Sinopharm) in Healthcare Workers: A Cohort Study.
- Published in:
- Tropical Medicine & Infectious Disease, 2022, v. 7, n. 5, p. 66, doi. 10.3390/tropicalmed7050066
- By:
- Publication type:
- Article
Congenital pulmonary airway malformation (CPAM) mimicking an spontaneous pneumothorax in a newborn.
- Published in:
- Cirugía Pediátrica (English Edition), 2021, v. 34, n. 4, p. 207
- By:
- Publication type:
- Article
Short Communications.
- Published in:
- Contact Dermatitis (01051873), 1998, v. 39, n. 4, p. 192
- By:
- Publication type:
- Article
EP14.04: Prediction of small-for-gestational-age neonates at term by second and third trimester fetal biometry using INTERGROWTH-21st and high altitude charts at 3,400m above sea level.
- Published in:
- Ultrasound in Obstetrics & Gynecology, 2017, v. 50, p. 315, doi. 10.1002/uog.18520
- By:
- Publication type:
- Article
Susceptibility of Chromatin to Nuclease Digestion in Dormant and Proliferating Meristems of Allium cepa Roots.
- Published in:
- Annals of Botany, 1983, v. 51, n. 3, p. 347
- By:
- Publication type:
- Article
Inhibition of RNA Synthesis and the Relationship between Nucleolar and Mitotic Cycles in Zea mays Root Meristems.
- Published in:
- Annals of Botany, 1974, v. 38, n. 5, p. 961
- By:
- Publication type:
- Article
Plant Chromatin Replicated in the Absence of Protein Synthesis.
- Published in:
- Journal of Experimental Botany, 1983, v. 34, n. 12, p. 1748
- By:
- Publication type:
- Article
The Nucleolus in the Induced Amitosis.
- Published in:
- Journal of Experimental Botany, 1975, v. 26, n. 5, p. 713
- By:
- Publication type:
- Article
Near-surface temperature gradient in a coastal upwelling regime.
- Published in:
- Journal of Geophysical Research. Oceans, 2014, v. 119, n. 8, p. 4972, doi. 10.1002/2014JC010074
- By:
- Publication type:
- Article
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
- Published in:
- International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 539, doi. 10.1111/ijlh.12692
- By:
- Publication type:
- Article
Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha<sup>0</sup>-thalassemia deletions - -<sup>Mex1</sup> and - -<sup>Mex2</sup>.
- Published in:
- International Journal of Laboratory Hematology, 2016, v. 38, n. 5, p. 535, doi. 10.1111/ijlh.12536
- By:
- Publication type:
- Article
Translation, cultural adaptation, and validation of the Venous International Assessment Scale to European Portuguese.
- Published in:
- Revista de Enfermagem Referência, 2021, n. 7, p. 1, doi. 10.12707/RV20135
- By:
- Publication type:
- Article
CONGENITAL MELANOCYTIC NEVUS WITH MILIA.
- Published in:
- 2016
- By:
- Publication type:
- Image
Validation of a Prediction Score for Drug-Resistant Microorganisms in Community-acquired Pneumonia.
- Published in:
- 2021
- By:
- Publication type:
- journal article
Cytoplasmic birefringent needle-like inclusions in hepatocytes in a patient with hepatoerythropoietic porphyria.
- Published in:
- 2004
- By:
- Publication type:
- Letter
Successful Aging at Work: Psychometric Properties of the Spanish Version of Selection, Optimization and Compensation Questionnaire.
- Published in:
- Frontiers in Psychology, 2018, p. 1, doi. 10.3389/fpsyg.2018.00410
- By:
- Publication type:
- Article
Absence of an N-Linked Glycosylation Motif in the Glycoprotein of the Live-Attenuated Argentine Hemorrhagic Fever Vaccine, Candid #1, Results in Its Improper Processing, and Reduced Surface Expression.
- Published in:
- Frontiers in Cellular & Infection Microbiology, 2017, v. 7, p. 2, doi. 10.3389/fcimb.2017.00020
- By:
- Publication type:
- Article
Administration of low doses of fish oil derived N-3 fatty acids to elderly subjects.
- Published in:
- 1997
- By:
- Publication type:
- journal article
Giant verrucous lesion on the scalp.
- Published in:
- Clinical & Experimental Dermatology, 2011, v. 36, n. 8, p. 925, doi. 10.1111/j.1365-2230.2011.04068.x
- By:
- Publication type:
- Article
Leiomyosarcoma arising from scrofuloderma scar.
- Published in:
- 2008
- By:
- Publication type:
- Letter
Nevus oligemicus: a case series.
- Published in:
- Journal of the European Academy of Dermatology & Venereology, 2013, v. 27, n. 3, p. e406, doi. 10.1111/j.1468-3083.2012.04641.x
- By:
- Publication type:
- Article
Bilateral segmental lentiginosis associated with malignant melanomas.
- Published in:
- 2008
- By:
- Publication type:
- Letter
Unilateral areolar sebaceous hyperplasia in a male.
- Published in:
- 2007
- By:
- Publication type:
- Letter
Chronic leg ulcers and basal cell carcinoma.
- Published in:
- 2006
- By:
- Publication type:
- Letter
Patterned localized siderosis mimicking pigmented tumour.
- Published in:
- 2006
- By:
- Publication type:
- Letter
Inpatient dermatology: characteristics of patients and admissions in a Spanish hospital<sup>1</sup>.
- Published in:
- Journal of the European Academy of Dermatology & Venereology, 2002, v. 16, n. 4, p. 334, doi. 10.1046/j.1468-3083.2002.00473.x
- By:
- Publication type:
- Article
CELL CYCLE MAPPING BY IRRADIATING CELLS WITH BROMOSUBSTITUTED DNA SEGMENTS.
- Published in:
- Photochemistry & Photobiology, 1979, v. 29, n. 5, p. 977, doi. 10.1111/j.1751-1097.1979.tb07801.x
- By:
- Publication type:
- Article
Characterization, expression and subcellular distribution of a novel MFP1 (matrix attachment region-binding filament-like protein 1) in onion.
- Published in:
- Protoplasma, 2008, v. 233, n. 1/2, p. 31, doi. 10.1007/s00709-008-0308-9
- By:
- Publication type:
- Article
Loss of Anti-Viral Immunity by Infection with a Virus Encoding a Cross-Reactive Pathogenic Epitope.
- Published in:
- PLoS Pathogens, 2012, v. 8, n. 4, p. 1, doi. 10.1371/journal.ppat.1002633
- By:
- Publication type:
- Article
Reverse-genetic approaches to the study of Borna disease virus.
- Published in:
- Nature Reviews Microbiology, 2006, v. 4, n. 10, p. 777, doi. 10.1038/nrmicro1489
- By:
- Publication type:
- Article
Effect of caffeine on in vivo processing of alkylated bases in proliferating plant cells
- Published in:
- Cell Biology International, 2003, v. 27, n. 10, p. 837, doi. 10.1016/S1065-6995(03)00169-0
- By:
- Publication type:
- Article
Intermediate filament proteins with nuclear functions: NuMA, lamin-like proteins and MFP1
- Published in:
- Cell Biology International, 2003, v. 27, n. 3, p. 233, doi. 10.1016/S1065-6995(02)00340-2
- By:
- Publication type:
- Article
Overexpression of GRK2 in Alzheimer Disease and in a Chronic Hypoperfusion Rat Model is an Early Marker of Brain Mitochondrial Lesions.
- Published in:
- Neurotoxicity Research, 2006, v. 10, n. 1, p. 43, doi. 10.1007/BF03033333
- By:
- Publication type:
- Article
La reforma constitucional. Sujeto y límites del poder constituyente.
- Published in:
- Revista de Estudios Políticos, 2019, n. 185, p. 336
- By:
- Publication type:
- Article
EL ESTADO CONSTITUCIONAL COMO CULTURA DEMOCRÁTICA DE LA JUSTIFICACIÓN.
- Published in:
- Revista de Estudios Políticos, 2018, n. 182, p. 13, doi. 10.18042/cepc/rep.182.01
- By:
- Publication type:
- Article
Upcoming Meetings Related to Alzheimer's Disease.
- Published in:
- 2010
- By:
- Publication type:
- Calendar
Basics of Alzheimer's Disease Prevention.
- Published in:
- Journal of Alzheimer's Disease, 2010, v. 20, n. 3, p. 687, doi. 10.3233/JAD-2010-091580
- By:
- Publication type:
- Article
Alzheimer's Disease is Incurable but Preventable.
- Published in:
- Journal of Alzheimer's Disease, 2010, v. 20, n. 3, p. 861, doi. 10.3233/JAD-2010-091579
- By:
- Publication type:
- Article
Alzheimer's disease prevalence can be lowered with non-invasive testing.
- Published in:
- 2008
- By:
- Publication type:
- journal article
Alzheimer's Disease Prevalence can be Lowered with Non-Invasive Testing.
- Published in:
- Journal of Alzheimer's Disease, 2008, v. 14, n. 3, p. 353, doi. 10.3233/JAD-2008-14310
- By:
- Publication type:
- Article
The maintenance of colchicine-arrested metaphases in plants requires protein synthesis.
- Published in:
- Cell Proliferation, 1989, v. 22, n. 4, p. 319, doi. 10.1111/j.1365-2184.1989.tb00217.x
- By:
- Publication type:
- Article
The Effect of Thermal Shock On the Division Cycle of Meristematic Cells.
- Published in:
- Cell Proliferation, 1971, v. 4, n. 6, p. 569, doi. 10.1111/j.1365-2184.1971.tb01564.x
- By:
- Publication type:
- Article
Direct Measurement of the G.
- Published in:
- Cell Proliferation, 1971, v. 4, n. 6, p. 563, doi. 10.1111/j.1365-2184.1971.tb01563.x
- By:
- Publication type:
- Article
Generalized Bullous Fixed Drug Eruption after Influenza Vaccination, Simulating Bullous Pemphigoid.
- Published in:
- Acta Dermato-Venereologica, 2001, v. 81, n. 6, p. 450, doi. 10.1080/000155501317208534
- By:
- Publication type:
- Article
Disseminated Superficial Porokeratosis with Mucosal Involvement.
- Published in:
- Acta Dermato-Venereologica, 2001, v. 81, n. 1, p. 64, doi. 10.1080/000155501750208290
- By:
- Publication type:
- Article