Found: 157
Select item for more details and to access through your institution.
Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.
- Published in:
- 2022
- By:
- Publication type:
- journal article
Guidelines for the management of postoperative obstructive symptoms in children with Hirschsprung disease.
- Published in:
- 2017
- By:
- Publication type:
- journal article
Organic Thin Film Transistors with Polymer Brush Gate Dielectrics Synthesized by Atom Transfer Radical Polymerization.
- Published in:
- Advanced Functional Materials, 2008, v. 18, n. 1, p. 36, doi. 10.1002/adfm.200700540
- By:
- Publication type:
- Article
Nanostructured phenolic matrices: Effect of different nanofillers on the thermal degradation properties and reaction to fire of a resol.
- Published in:
- Fire & Materials, 2017, v. 41, n. 7, p. 817, doi. 10.1002/fam.2425
- By:
- Publication type:
- Article
Dilution Versus Pollution in Watercourses Affected by Acid Mine Drainage: A Graphic Model for the Iberian Pyrite Belt (SW Spain).
- Published in:
- Mine Water & the Environment, 2018, v. 37, n. 1, p. 211, doi. 10.1007/s10230-017-0495-8
- By:
- Publication type:
- Article
Characterisation of AMD Pollution in the Reservoirs of the Iberian Pyrite Belt.
- Published in:
- Mine Water & the Environment, 2013, v. 32, n. 4, p. 321, doi. 10.1007/s10230-013-0236-6
- By:
- Publication type:
- Article
Immune recovery and T cell subset analysis during effective treatment with maraviroc.
- Published in:
- 2012
- By:
- Publication type:
- Journal Article
Las razones geológicas de la minería del cobre.
- Published in:
- Boletín Geológico y Minero, 2019, v. 130, n. 1, p. 133, doi. 10.21701/bolgeomin.130.1.009
- By:
- Publication type:
- Article
Sequence analysis of exons 30 and 31 of LAMA3 gene variants and its association with human papillomavirus infection predisposition: no evidence was found.
- Published in:
- European Review for Medical & Pharmacological Sciences, 2023, v. 27, n. 14, p. 6860
- By:
- Publication type:
- Article
Mutational spectrum of the iduronate-2-sulfatase gene in Mexican patients with Hunter syndrome.
- Published in:
- European Review for Medical & Pharmacological Sciences, 2022, v. 26, n. 14, p. 5115
- By:
- Publication type:
- Article
Survey of occupational risks in the agricultural sector of northeastern Buenos Aires, Argentina.
- Published in:
- Argentinian Horticulture / Horticultura Argentina, 2022, v. 41, n. 105, p. 117
- By:
- Publication type:
- Article
REPRODUCIBILITY OF 24-HOUR NON-INVASIVE AMBULATORY BLOOD PRESSURE MONITORING USING THE SUNTECH ACCUTRACKER.
- Published in:
- Clinical & Experimental Pharmacology & Physiology, 1989, v. 16, n. 4, p. 247, doi. 10.1111/j.1440-1681.1989.tb01552.x
- By:
- Publication type:
- Article
Brachial plexopathy following a generalized tonic–clonic seizure.
- Published in:
- 2007
- By:
- Publication type:
- Letter
Non-convulsive status epilepticus as an unrecognized cause of acute confusion in alcoholics.
- Published in:
- 2007
- By:
- Publication type:
- Letter
Densidad mamaria, lex artis ad hoc y educación a mujeres latinoamericanas.
- Published in:
- Anales de Radiologia, Mexico, 2021, v. 20, n. 4, p. 237, doi. 10.24875/ARM.21000076
- By:
- Publication type:
- Article
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
- Published in:
- International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 539, doi. 10.1111/ijlh.12692
- By:
- Publication type:
- Article
Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha<sup>0</sup>-thalassemia deletions - -<sup>Mex1</sup> and - -<sup>Mex2</sup>.
- Published in:
- International Journal of Laboratory Hematology, 2016, v. 38, n. 5, p. 535, doi. 10.1111/ijlh.12536
- By:
- Publication type:
- Article
Quality indicators in radiation oncology: proposal of the Spanish Society of Radiation Oncology (SEOR) for a continuous improvement of the quality of care in oncology.
- Published in:
- Clinical & Translational Oncology, 2019, v. 21, n. 4, p. 519, doi. 10.1007/s12094-018-1943-z
- By:
- Publication type:
- Article
Prognostic utility of duration in refractory nonconvulsive status epilepticus.
- Published in:
- 2010
- By:
- Publication type:
- Letter
Nonconvulsive Status Epilepticus versus Triphasic Encephalopathy.
- Published in:
- 2007
- By:
- Publication type:
- Letter
Status Epilepticus in Idiopathic Generalized Epilepsy.
- Published in:
- 2006
- By:
- Publication type:
- Letter
Response: Nonconvulsive Status Epilepticus after Temporal Lobectomy.
- Published in:
- 2006
- By:
- Publication type:
- Letter
Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century.
- Published in:
- Atmospheric Chemistry & Physics, 2009, v. 9, n. 23, p. 9143, doi. 10.5194/acp-9-9143-2009
- By:
- Publication type:
- Article
A snapshot of the oxygenation of mechanically ventilated patients in one Australian intensive care unit.
- Published in:
- 2017
- By:
- Publication type:
- journal article
Buprenorphine-related complications in elderly hospitalised patients: a case series.
- Published in:
- 2017
- By:
- Publication type:
- journal article
Pharmacokinetic behaviour of perphenazine in sheep after intramuscular administration of a long-acting formulation.
- Published in:
- Journal of Veterinary Pharmacology & Therapeutics, 2009, v. 32, n. 3, p. 306, doi. 10.1111/j.1365-2885.2008.01032.x
- By:
- Publication type:
- Article
Eco‐sustainable silk sericin from by‐product of textile industry can be employed for cosmetic, dermatology and drug delivery.
- Published in:
- Journal of Chemical Technology & Biotechnology, 2020, v. 95, n. 9, p. 2549, doi. 10.1002/jctb.6441
- By:
- Publication type:
- Article
Parasitoses intestinais numa população de idade pediátrica do Hospital Professor Doutor Fernando Fonseca, EPE.
- Published in:
- RPDI - Revista Portuguesa de Doenças Infecciosas, 2021, v. 16, n. 3, p. 109
- By:
- Publication type:
- Article
FORMULATION AND CHARACTERIZATION OF SILK FIBROIN FILMS AS A SCAFFOLD FOR ADIPOSF-DERIVFD STEM CELLS IN SKIN TISSUE ENGINEERING.
- Published in:
- International Journal of Immunopathology & Pharmacology, 2013, v. 26, n. 1s, p. 43, doi. 10.1177/03946320130260S106
- By:
- Publication type:
- Article
Stratification of Metal and Sulphate Loads in Acid Mine Drainage Receiving Water Dams -- Variables Regionalization by Cluster Analysis.
- Published in:
- Water Environment Research (10614303), 2015, v. 87, n. 7, p. 626, doi. 10.2175/106143015X14212658614793
- By:
- Publication type:
- Article
Acromegaly Is More Severe in Patients With AHR or AIP Gene Variants Living in Highly Polluted Areas.
- Published in:
- 2016
- By:
- Publication type:
- journal article
Breast cancer chemotherapy treatment monitoring based on serum sample Raman spectroscopy.
- Published in:
- Lasers in Medical Science, 2022, v. 37, n. 9, p. 3649, doi. 10.1007/s10103-022-03646-5
- By:
- Publication type:
- Article
Efficacy and Compliance to Prolonged Duovent Treatment of Bronchospasm.
- Published in:
- Respiration, 1986, v. 50, n. S2, p. 222, doi. 10.1159/000195132
- By:
- Publication type:
- Article
A single dose of a suicidal DNA vaccine induces a specific immune response in salmonids.
- Published in:
- Journal of Fish Diseases, 2015, v. 38, n. 6, p. 581, doi. 10.1111/jfd.12274
- By:
- Publication type:
- Article
Acute myocardial infarction as the first manifestation of antiphospholipid syndrome.
- Published in:
- CorSalud, 2014, v. 6, n. 3, p. 271
- By:
- Publication type:
- Article
Life Cycle Analysis of Extruded Films Based on Poly(lactic acid)/Cellulose Nanocrystal/Limonene: A Comparative Study with ATBC Plasticized PLA/OMMT Systems.
- Published in:
- Journal of Polymers & the Environment, 2018, v. 26, n. 5, p. 1891, doi. 10.1007/s10924-017-1085-3
- By:
- Publication type:
- Article
Extraction of Cellulose Nanocrystals from Phormium tenax Fibres.
- Published in:
- Journal of Polymers & the Environment, 2013, v. 21, n. 2, p. 319, doi. 10.1007/s10924-012-0543-1
- By:
- Publication type:
- Article
Physics Experiments at the UNEDLabs Portal.
- Published in:
- International Journal of Online Engineering, 2012, v. 8, n. 1, p. 26
- By:
- Publication type:
- Article
'Ictus emeticus in a prolonged frontotemporal seizure secondary to a brain tumour'.
- Published in:
- 2005
- By:
- Publication type:
- Case Study
Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century.
- Published in:
- Atmospheric Chemistry & Physics Discussions, 2009, v. 9, n. 5, p. 18597, doi. 10.5194/acpd-9-18597-2009
- By:
- Publication type:
- Article
Detailed electroencephalographic long-term follow-up study in Lewy body dementia with periodic sharp wave complexes.
- Published in:
- Journal of Neurology, 2007, v. 254, n. 3, p. 384, doi. 10.1007/s00415-006-0367-9
- By:
- Publication type:
- Article
Localisation–related nonconvulsive status epilepticus.
- Published in:
- Journal of Neurology, 2006, v. 253, n. 3, p. 392, doi. 10.1007/s00415-005-0978-6
- By:
- Publication type:
- Article
Effects of antiretroviral therapy in patients with Charcot-Marie-Tooth disease type 1A.
- Published in:
- 2002
- By:
- Publication type:
- Letter
Total Lipids, Caloric Value, and Fatty Acids Content of Colostrum of Adolescent Mothers of Small for Gestational Age Term Infants.
- Published in:
- Annals of the New York Academy of Sciences, 1997, v. 817, n. 1, p. 384, doi. 10.1111/j.1749-6632.1997.tb48233.x
- By:
- Publication type:
- Article
Reinforcement effect of cellulose nanocrystals in thermoplastic polyurethane matrices characterized by different soft/hard segment ratio.
- Published in:
- Polymer Engineering & Science, 2017, v. 57, n. 6, p. 521, doi. 10.1002/pen.24532
- By:
- Publication type:
- Article
Numerical simulation of bending and failure behaviour of z-core sandwich panels.
- Published in:
- Plastics, Rubber & Composites, 2007, v. 36, n. 9, p. 389, doi. 10.1179/174328907X248195
- By:
- Publication type:
- Article
Processing and properties of recycled polypropylene modified with elastomers.
- Published in:
- Plastics, Rubber & Composites, 2003, v. 32, n. 8/9, p. 357, doi. 10.1179/146580103225004126
- By:
- Publication type:
- Article
Dimensional analysis of milk fat globules in sow milk: effects of the lactation stage and fat content and comparison with vaccine milk.
- Published in:
- 2010
- By:
- Publication type:
- Editorial
Time Evolution of an AMD-Affected River Chemical Makeup.
- Published in:
- Water Resources Management, 2009, v. 23, n. 7, p. 1275, doi. 10.1007/s11269-008-9326-9
- By:
- Publication type:
- Article
Nitrate Accumulation and Other Components of the Groundwater in Relation to Cropping System in an Aquifer in Southwestern Spain.
- Published in:
- Water Resources Management, 2005, v. 19, n. 1, p. 1
- By:
- Publication type:
- Article