Found: 66
Select item for more details and to access through your institution.
Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.
- Published in:
- 2022
- By:
- Publication type:
- journal article
Dilution Versus Pollution in Watercourses Affected by Acid Mine Drainage: A Graphic Model for the Iberian Pyrite Belt (SW Spain).
- Published in:
- Mine Water & the Environment, 2018, v. 37, n. 1, p. 211, doi. 10.1007/s10230-017-0495-8
- By:
- Publication type:
- Article
Characterisation of AMD Pollution in the Reservoirs of the Iberian Pyrite Belt.
- Published in:
- Mine Water & the Environment, 2013, v. 32, n. 4, p. 321, doi. 10.1007/s10230-013-0236-6
- By:
- Publication type:
- Article
Las razones geológicas de la minería del cobre.
- Published in:
- Boletín Geológico y Minero, 2019, v. 130, n. 1, p. 133, doi. 10.21701/bolgeomin.130.1.009
- By:
- Publication type:
- Article
Sequence analysis of exons 30 and 31 of LAMA3 gene variants and its association with human papillomavirus infection predisposition: no evidence was found.
- Published in:
- European Review for Medical & Pharmacological Sciences, 2023, v. 27, n. 14, p. 6860
- By:
- Publication type:
- Article
Mutational spectrum of the iduronate-2-sulfatase gene in Mexican patients with Hunter syndrome.
- Published in:
- European Review for Medical & Pharmacological Sciences, 2022, v. 26, n. 14, p. 5115
- By:
- Publication type:
- Article
Densidad mamaria, lex artis ad hoc y educación a mujeres latinoamericanas.
- Published in:
- Anales de Radiologia, Mexico, 2021, v. 20, n. 4, p. 237, doi. 10.24875/ARM.21000076
- By:
- Publication type:
- Article
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
- Published in:
- International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 539, doi. 10.1111/ijlh.12692
- By:
- Publication type:
- Article
Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha<sup>0</sup>-thalassemia deletions - -<sup>Mex1</sup> and - -<sup>Mex2</sup>.
- Published in:
- International Journal of Laboratory Hematology, 2016, v. 38, n. 5, p. 535, doi. 10.1111/ijlh.12536
- By:
- Publication type:
- Article
Quality indicators in radiation oncology: proposal of the Spanish Society of Radiation Oncology (SEOR) for a continuous improvement of the quality of care in oncology.
- Published in:
- Clinical & Translational Oncology, 2019, v. 21, n. 4, p. 519, doi. 10.1007/s12094-018-1943-z
- By:
- Publication type:
- Article
Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century.
- Published in:
- Atmospheric Chemistry & Physics, 2009, v. 9, n. 23, p. 9143, doi. 10.5194/acp-9-9143-2009
- By:
- Publication type:
- Article
Pharmacokinetic behaviour of perphenazine in sheep after intramuscular administration of a long-acting formulation.
- Published in:
- Journal of Veterinary Pharmacology & Therapeutics, 2009, v. 32, n. 3, p. 306, doi. 10.1111/j.1365-2885.2008.01032.x
- By:
- Publication type:
- Article
Stratification of Metal and Sulphate Loads in Acid Mine Drainage Receiving Water Dams -- Variables Regionalization by Cluster Analysis.
- Published in:
- Water Environment Research (10614303), 2015, v. 87, n. 7, p. 626, doi. 10.2175/106143015X14212658614793
- By:
- Publication type:
- Article
Breast cancer chemotherapy treatment monitoring based on serum sample Raman spectroscopy.
- Published in:
- Lasers in Medical Science, 2022, v. 37, n. 9, p. 3649, doi. 10.1007/s10103-022-03646-5
- By:
- Publication type:
- Article
Acute myocardial infarction as the first manifestation of antiphospholipid syndrome.
- Published in:
- CorSalud, 2014, v. 6, n. 3, p. 271
- By:
- Publication type:
- Article
Physics Experiments at the UNEDLabs Portal.
- Published in:
- International Journal of Online Engineering, 2012, v. 8, n. 1, p. 26
- By:
- Publication type:
- Article
Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century.
- Published in:
- Atmospheric Chemistry & Physics Discussions, 2009, v. 9, n. 5, p. 18597, doi. 10.5194/acpd-9-18597-2009
- By:
- Publication type:
- Article
Time Evolution of an AMD-Affected River Chemical Makeup.
- Published in:
- Water Resources Management, 2009, v. 23, n. 7, p. 1275, doi. 10.1007/s11269-008-9326-9
- By:
- Publication type:
- Article
Nitrate Accumulation and Other Components of the Groundwater in Relation to Cropping System in an Aquifer in Southwestern Spain.
- Published in:
- Water Resources Management, 2005, v. 19, n. 1, p. 1
- By:
- Publication type:
- Article
Coccidioidomycosis mimicking testicular cancer: A case report.
- Published in:
- Andrologia, 2021, v. 53, n. 8, p. 1, doi. 10.1111/and.14151
- By:
- Publication type:
- Article
Social determinants in the access to health care for Chagas disease: A qualitative research on family life in the "Valle Alto" of Cochabamba, Bolivia.
- Published in:
- PLoS ONE, 2021, v. 16, n. 8, p. 1, doi. 10.1371/journal.pone.0255226
- By:
- Publication type:
- Article
Factors influencing metal price selection in mining feasibility studies.
- Published in:
- Mining Engineering, 2013, v. 65, n. 8, p. 45
- By:
- Publication type:
- Article
Incisional Hernia: Plastic Aspects, Component Separation, Technical Details & Pediatrics.
- Published in:
- 2015
- By:
- Publication type:
- journal article
Application of a Systemic Approach to the Study of Pollution of the Tinto and Odiel Rivers (Spain).
- Published in:
- Environmental Monitoring & Assessment, 2005, v. 102, n. 1-3, p. 435, doi. 10.1007/s10661-005-6396-5
- By:
- Publication type:
- Article
Technical note: Recording rules for behavioral studies in growing heifers fed high-concentrate diets.
- Published in:
- Journal of Animal Science, 2017, v. 95, n. 6, p. 2339, doi. 10.2527/jas.2016.1037
- By:
- Publication type:
- Article
Feed intake, ruminai fermentation, and animal behavior of beef heifers fed forage free diets containing nonforage fiber sources.
- Published in:
- Journal of Animal Science, 2013, v. 91, n. 8, p. 3827, doi. 10.2527/jas.2012-5803
- By:
- Publication type:
- Article
Effects of ring castration with local anesthesia and analgesia in Holstein calves at 3 months of age on welfare indicators.
- Published in:
- Journal of Animal Science, 2010, v. 88, n. 8, p. 2789, doi. 10.2527/jas.2009-2408
- By:
- Publication type:
- Article
Performance, behavior, and welfare of Friesian heifers housed in pens with two, four, and eight individuals per concentrate feeding place.
- Published in:
- Journal of Animal Science, 2008, v. 86, n. 6, p. 1446, doi. 10.2527/jas.2007-0675
- By:
- Publication type:
- Article
Effect of the number of concentrate feeding places per pen on performance, behavior, and welfare indicators of Friesian calves during the first month after arrival at the feedlot.
- Published in:
- Journal of Animal Science, 2008, v. 86, n. 2, p. 419, doi. 10.2527/jas.2007-0362
- By:
- Publication type:
- Article
Effect of number of feeding places per pen on performance, blood metabolites and haptoglobin of Holstein heifers on highconcentrate diets.
- Published in:
- Journal of Animal Science, 2006, v. 84, p. 419
- By:
- Publication type:
- Article
Effect of number of feeding places per pen on performance, blood metabolites and haptoglobin during the first month of adaptation to the feedlot.
- Published in:
- Journal of Animal Science, 2006, v. 84, p. 419
- By:
- Publication type:
- Article
Effects of dietary nonstructural carbohydrates and protein sources on feeding behavior of tethered heifers fed high-concentrate diets.
- Published in:
- Journal of Animal Science, 2006, v. 84, n. 5, p. 1197, doi. 10.2527/2006.8451197x
- By:
- Publication type:
- Article
Una revisión de la literatura experimental sobre los efectos motivacionales del alcohol y su modulación por factores biológicos y ambientales.
- Published in:
- Anales de Psicología, 2013, v. 29, n. 3, p. 934, doi. 10.6018/analesps.29.3.154561
- By:
- Publication type:
- Article
Promoting cancer screening among churchgoing Latinas: Fe en Acción/faith in action.
- Published in:
- Health Education Research, 2017, v. 32, n. 2, p. 163, doi. 10.1093/her/cyx033
- By:
- Publication type:
- Article
Quasi-biennial modulation of the Northern Hemisphere tropopause height and temperature.
- Published in:
- Journal of Geophysical Research. Atmospheres, 2008, v. 113, n. D7, p. n/a, doi. 10.1029/2007JD009765
- By:
- Publication type:
- Article
The paradigm of Circular Mining in the world: the Iberian Pyrite Belt as a potential scenario of interaction.
- Published in:
- Environmental Earth Sciences, 2018, v. 77, n. 10, p. 1, doi. 10.1007/s12665-018-7577-1
- By:
- Publication type:
- Article
Spatial distribution of major and trace elements in a mining dam: sources and relationships among elements of environmental concern.
- Published in:
- Environmental Earth Sciences, 2016, v. 75, n. 4, p. 1, doi. 10.1007/s12665-015-4863-z
- By:
- Publication type:
- Article
TEMPERATURAS DE INCUBACIÓN Y PROPORCIÓN SEXUAL EN NIDOS DE TORTUGAS MARINAS DE LA PLAYA SAN JUAN CHACAHUA, OAXACA, MÉXICO.
- Published in:
- Agro Productividad, 2017, v. 10, n. 5, p. 39
- By:
- Publication type:
- Article
Baroclinic Rossby Wave Forcing and Barotropic Rossby Wave Response to Stratospheric Vortex Variability.
- Published in:
- Journal of the Atmospheric Sciences, 2009, v. 66, n. 4, p. 902, doi. 10.1175/2008JAS2862.1
- By:
- Publication type:
- Article
Wave Energy Associated with the Variability of the Stratospheric Polar Vortex.
- Published in:
- Journal of the Atmospheric Sciences, 2007, v. 64, n. 7, p. 2683, doi. 10.1175/JAS3978.1
- By:
- Publication type:
- Article
Annular versus Nonannular Variability of the Northern Hemisphere Atmospheric Circulation.
- Published in:
- Journal of Climate, 2008, v. 21, n. 13, p. 3180, doi. 10.1175/2007JCLI1960.1
- By:
- Publication type:
- Article
Follicular Development and Secretion of Ovarian Hormones during the Juvenile and Adult Reproductive Lives of the Myelin Mutant taiep Rat: An Animal Model of Demyelinating Diseases.
- Published in:
- International Journal of Endocrinology, 2018, p. 1, doi. 10.1155/2018/5718782
- By:
- Publication type:
- Article
Effects of vehicle movements during transport on the stress responses and meat quality of sheep.
- Published in:
- Veterinary Record: Journal of the British Veterinary Association, 2001, v. 148, n. 8, p. 227, doi. 10.1136/vr.148.8.227
- By:
- Publication type:
- Article
Factors affecting the effectiveness of head-only electrical stunning in sheep.
- Published in:
- Veterinary Record: Journal of the British Veterinary Association, 2000, v. 147, n. 2, p. 40, doi. 10.1136/vr.147.2.40
- By:
- Publication type:
- Article
Surgical maneuvers for long-segment Hirschsprung pull-through in unique patients.
- Published in:
- Pediatric Surgery International, 2024, v. 40, n. 1, p. 1, doi. 10.1007/s00383-024-05767-0
- By:
- Publication type:
- Article
Standardization of radiograph readings during bowel management week.
- Published in:
- Pediatric Surgery International, 2023, v. 39, n. 1, p. 1, doi. 10.1007/s00383-023-05513-y
- By:
- Publication type:
- Article
Incidence of medullary thyroid carcinoma and Hirschsprung disease based on the cosmos database.
- Published in:
- Pediatric Surgery International, 2023, v. 39, n. 1, p. 1, doi. 10.1007/s00383-023-05511-0
- By:
- Publication type:
- Article
Do adult patients with congenital colorectal conditions know their diagnosis?
- Published in:
- Pediatric Surgery International, 2022, v. 38, n. 12, p. 1723, doi. 10.1007/s00383-022-05220-0
- By:
- Publication type:
- Article
Guidelines for the management of postoperative soiling in children with Hirschsprung disease.
- Published in:
- 2019
- By:
- Publication type:
- journal article
Guidelines for the management of postoperative obstructive symptoms in children with Hirschsprung disease.
- Published in:
- 2017
- By:
- Publication type:
- journal article