Works matching IS 17515521 AND DT 2017 AND VI 39 AND IP 5

Results: 25

Multicenter verification of the Sysmex XN-Series.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 489, doi. 10.1111/ijlh.12674

By:

Schoorl, M.;
Chevallier, M.;
Ploeg, T.;
Pelt, J.

Publication type:

Article

ICSH recommendations for modified and alternate methods measuring the erythrocyte sedimentation rate.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 448, doi. 10.1111/ijlh.12693

By:

Kratz, A.;
Plebani, M.;
Peng, M.;
Lee, Y.K.;
McCafferty, R.;
Machin, S.J.

Publication type:

Article

Relationship between red blood cell distribution width, bilirubin, and clinical characteristics of patients with gastric cancer.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 497, doi. 10.1111/ijlh.12675

By:

Wei, T.‐T.;
Wang, L.‐L.;
Yin, J.‐R.;
Liu, Y.‐T.;
Qin, B.‐D.;
Li, J.‐Y.;
Yin, X.;
Zhou, L.;
Zhong, R.‐Q.

Publication type:

Article

Assessment of semi-quantitative grading of red blood cell abnormalities utilizing images from the CellaVision DM96 compared to manual light microscopy.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e110, doi. 10.1111/ijlh.12673

By:

Nakashima, M. O.;
Doyle, T. J.;
Phelan‐Lewin, K.;
Summers, J. M.;
Bena, J.;
Hsi, E. D.

Publication type:

Article

Co-inheritance of α0-thalassemia elevates Hb A2 level in homozygous Hb E: Diagnostic implications.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 508, doi. 10.1111/ijlh.12677

By:

Singha, K.;
Srivorakun, H.;
Fucharoen, G.;
Fucharoen, S.

Publication type:

Article

Diagnosis and molecular characterization of a novel α0-thalassemia deletion (- Kozani) found in a Greek child with unexplained microcytic hypochromic anemia.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e124, doi. 10.1111/ijlh.12690

By:

Makis, A.;
Georgiou, I.;
Traeger‐Synodinos, J.;
Chaliasos, N.;
Grosso, M.;
Gambale, A.;
Iolascon, A.

Publication type:

Article

A performance evaluation of a novel human recombinant tissue factor prothrombin time reagent (Revohem™ PT).

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 532, doi. 10.1111/ijlh.12691

By:

Gardiner, C.;
Kohama, K.;
Patel, I.;
Lane, P.;
Dwyer, S.;
Machin, S. J.;
Mackie, I. J.

Publication type:

Article

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 539, doi. 10.1111/ijlh.12692

By:

Rizo‐de‐la‐Torre, L. C.;
Ibarra, B.;
Sánchez‐López, J. Y.;
Magaña‐Torres, M. T.;
Rentería‐López, V. M.;
Perea‐Díaz, F. J.

Publication type:

Article

The evaluation of the relevance of thrombin generation and procoagulant activity in thrombotic risk assessment in BCR- ABL-negative myeloproliferative neoplasm patients.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 502, doi. 10.1111/ijlh.12676

By:

Baccouche, H.;
Ben Jemaa, M.;
Chakroun, A.;
Chadi, S.;
Mahjoub, S.;
Sfar, I.;
Gorgi, Y.;
Ben Romdhane, N.

Publication type:

Article

Higher rate of central nervous system involvement by flow cytometry than morphology in acute lymphoblastic leukemia.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 546, doi. 10.1111/ijlh.12694

By:

Dass, J.;
Dayama, A.;
Mishra, P. C.;
Mahapatra, M.;
Seth, T.;
Tyagi, S.;
Pati, H. P.;
Saxena, R.

Publication type:

Article

CD11c expression in chronic lymphocytic leukemia revisited, related with complications and survival.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 552, doi. 10.1111/ijlh.12695

By:

Umit, E. G.;
Baysal, M.;
Durmus, Y.;
Demir, A. M.

Publication type:

Article

Evaluation of whole-blood conservation reagents for Hematoflow-based WBC differential count: Unsatisfactory results.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e127, doi. 10.1111/ijlh.12697

By:

Wagner‐Ballon, O.;
Badaoui, B.;
Brignoli, A.;
Le Priol, J.;
Roussel, M.

Publication type:

Article

Issue Information.

Published in:: International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 439, doi. 10.1111/ijlh.12590
Publication type:: Article

Impact of different storage times at room temperature of unspun citrated blood samples on routine coagulation tests results. Results of a bicenter study and review of the literature.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 458, doi. 10.1111/ijlh.12660

By:

Toulon, P.;
Metge, S.;
Hangard, M.;
Zwahlen, S.;
Piaulenne, S.;
Besson, V.

Publication type:

Article

The frequency of occurrence of atypical lymphocytes in peripheral blood smears of natalizumab-treated patients with multiple sclerosis.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 469, doi. 10.1111/ijlh.12662

By:

Robier, C.;
Amouzadeh‐Ghadikolai, O.;
Bregant, C.;
Diez, J.;
Melinz, K.;
Quehenberger, F.;
Quasthoff, S.

Publication type:

Article

Frequency of polycythemia in individuals with normal complete blood cell counts according to the new 2016 WHO classification of myeloid neoplasms.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 528, doi. 10.1111/ijlh.12686

By:

Sandes, A. F.;
Gonçalves, M. V.;
Chauffaille, M. de L.

Publication type:

Article

Is it acceptable to use coagulation plasma samples stored at room temperature and 4°C for 24 hours for additional prothrombin time, activated partial thromboplastin time, fibrinogen, antithrombin, and D-dimer testing?

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 475, doi. 10.1111/ijlh.12664

By:

Rimac, V.;
Coen Herak, D.

Publication type:

Article

Critical values in hematology of 862 institutions in China.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 513, doi. 10.1111/ijlh.12681

By:

Ye, Y.Y.;
Zhao, H.J.;
Fei, Y.;
Wang, W.;
He, F.L.;
Zhong, K.;
Yuan, S.;
Wang, Z.G.

Publication type:

Article

Adopting automated image analysis tool for fibrin network: Can we obtain clot properties for practical application?

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e121, doi. 10.1111/ijlh.12689

By:

Yoon, J. G.;
Song, J.

Publication type:

Article

Evaluation of OSMOCELLS, a new semi-automatic device for osmotic fragility assessment.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 521, doi. 10.1111/ijlh.12683

By:

Gérard, D.;
Fattet, A‐J.;
Brakta, C.;
Phulpin, A.;
Steschenko, D.;
Lesesve, J‐F.;
Perrin, J.

Publication type:

Article

Profound spherocytosis in adulthood: Acquired, hereditary or both?

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e117, doi. 10.1111/ijlh.12685

By:

Langeveld, T. J. C.;
Rossum, A. P.;
Zwaag, B.;
Wijk, R.;
Vlasveld, L. Th.

Publication type:

Article

A comparative study using thrombin generation and three different INR methods in patients on Vitamin K antagonist treatment.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 482, doi. 10.1111/ijlh.12668

By:

Riva, N.;
Vella, K.;
Meli, S.;
Hickey, K.;
Zammit, D.;
Calamatta, C.;
Makris, M.;
Kitchen, S.;
Ageno, W.;
Gatt, A.

Publication type:

Article

Global assays of fibrinolysis.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. 441, doi. 10.1111/ijlh.12688

By:

Ilich, A.;
Bokarev, I.;
Key, N. S.

Publication type:

Article

Assessing the stability and suitability of haematology parameters for diagnosing and monitoring iron deficiency.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e132, doi. 10.1111/ijlh.12702

By:

Sellors, A.;
Melbourne, J.;
Barratt, J.;
Barton, L.

Publication type:

Article

Relevance of ethnic differences in factor XIII activity on laboratory reference ranges.

Published in:

International Journal of Laboratory Hematology, 2017, v. 39, n. 5, p. e113, doi. 10.1111/ijlh.12684

By:

Wong, W. H.;
Tan, C. K.;
Ho, L. P.;
Tan, C. W.;
Kaur, H.;
Lee, L. H.;
Ng, H. J.

Publication type:

Article

Works matching IS 17515521 AND DT 2017 AND VI 39 AND IP 5

Multicenter verification of the Sysmex XN-Series.

ICSH recommendations for modified and alternate methods measuring the erythrocyte sedimentation rate.

Relationship between red blood cell distribution width, bilirubin, and clinical characteristics of patients with gastric cancer.

Assessment of semi-quantitative grading of red blood cell abnormalities utilizing images from the CellaVision DM96 compared to manual light microscopy.

Co-inheritance of α<sup>0</sup>-thalassemia elevates Hb A<sub>2</sub> level in homozygous Hb E: Diagnostic implications.

Diagnosis and molecular characterization of a novel α<sup>0</sup>-thalassemia deletion (- Kozani) found in a Greek child with unexplained microcytic hypochromic anemia.

A performance evaluation of a novel human recombinant tissue factor prothrombin time reagent (Revohem<sup>™</sup> PT).

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

The evaluation of the relevance of thrombin generation and procoagulant activity in thrombotic risk assessment in BCR- ABL-negative myeloproliferative neoplasm patients.

Higher rate of central nervous system involvement by flow cytometry than morphology in acute lymphoblastic leukemia.

CD11c expression in chronic lymphocytic leukemia revisited, related with complications and survival.

Evaluation of whole-blood conservation reagents for Hematoflow-based WBC differential count: Unsatisfactory results.

Issue Information.

Impact of different storage times at room temperature of unspun citrated blood samples on routine coagulation tests results. Results of a bicenter study and review of the literature.

The frequency of occurrence of atypical lymphocytes in peripheral blood smears of natalizumab-treated patients with multiple sclerosis.

Frequency of polycythemia in individuals with normal complete blood cell counts according to the new 2016 WHO classification of myeloid neoplasms.

Is it acceptable to use coagulation plasma samples stored at room temperature and 4°C for 24 hours for additional prothrombin time, activated partial thromboplastin time, fibrinogen, antithrombin, and D-dimer testing?

Critical values in hematology of 862 institutions in China.

Adopting automated image analysis tool for fibrin network: Can we obtain clot properties for practical application?

Evaluation of OSMOCELLS, a new semi-automatic device for osmotic fragility assessment.

Profound spherocytosis in adulthood: Acquired, hereditary or both?

A comparative study using thrombin generation and three different INR methods in patients on Vitamin K antagonist treatment.

Global assays of fibrinolysis.

Assessing the stability and suitability of haematology parameters for diagnosing and monitoring iron deficiency.

Relevance of ethnic differences in factor XIII activity on laboratory reference ranges.