We found a match
Your institution may have rights to this item. Sign in to continue.
- Title
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite.
- Authors
Bilibana, Mawethu Pascoe; Feleni, Usisipho; Williams, Avril Rae; Iwuoha, Emmanuel
- Abstract
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.
- Subjects
SMALL-angle X-ray scattering; CARBON electrodes; LEUCINE; ENZYME-linked immunosorbent assay; NANOCOMPOSITE materials; IMPEDANCE spectroscopy
- Publication
Processes, 2021, Vol 9, Issue 1, p179
- ISSN
2227-9717
- Publication type
Article
- DOI
10.3390/pr9010179