We found a match
Your institution may have access to this item. Find your institution then sign in to continue.
- Title
Bioinformatics analysis of the s2m mutations within the SARS‐CoV‐2 Omicron lineages.
- Authors
Frye, Caleb J.; Shine, Morgan; Makowski, Joseph A.; Kensinger, Adam H.; Cunningham, Caylee L.; Milback, Ella J.; Evanseck, Jeffrey D.; Lackey, Patrick E.; Mihailescu, Mihaela Rita
- Abstract
The rise of the (7-32) s2m mutant as the dominant s2m phenotype suggests that this mutation may influence the overall fitness of the SARS-CoV-2 Omicron variant. Further sequences where the s2m was truncated at the 7th position (TTCACC-----------------------------------), identified as the (7-41) s2m, or which are truncated before the s2m, identified as "truncated before s2m" (TBs2m), were also accounted for and reported. Subsequently, s2m sequences were identified that were an exact match to the wild-type s2m, (TTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAA), or to the 26-nucleotide deletion within the s2m (TTCACC--------------------------TACAGTGAA), named " (7-32) s2m.".
- Subjects
SARS-CoV-2 Omicron variant; VIRAL tropism; SARS-CoV-2; GENETIC recombination; SARS disease
- Publication
Journal of Medical Virology, 2023, Vol 95, Issue 1, p1
- ISSN
0146-6615
- Publication type
Article
- DOI
10.1002/jmv.28141