We found a match
Your institution may have access to this item. Find your institution then sign in to continue.
- Title
Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations.
- Authors
Tan, Jin-ai M.a.; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N.; Soosay, ashley E.R.; Gudum, Henry R.; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J.; George, Elizabeth
- Abstract
Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α3.7/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel
- Subjects
SARAWAK; MALAYSIA; GENETICS of thalassemia; NUCLEOTIDE sequencing; HUMAN deletion mutation; BETA globin; MOLECULAR diagnosis; PUBLIC health; ETHNIC groups
- Publication
Public Health Genomics, 2015, Vol 18, Issue 1, p60
- ISSN
1662-4246
- Publication type
Article
- DOI
10.1159/000368342