We found a match
Your institution may have access to this item. Find your institution then sign in to continue.
- Title
In-silico Genome Editing Identification and Functional Protein Change of Chlamydomonas reinhardtii Acetyl-CoA Carboxylase (CrACCase).
- Authors
Pratami, Mentari Putri; Fendiyanto, Miftahul Huda; Satrio, Rizky Dwi; Nikmah, Isna Arofatun; Awwanah, Mo; Farah, Nadya; Permata Sari, Nastiti Intan; Nurhadiyanta
- Abstract
The Acetyl-Coa Carboxylase (CrACCase) in Chlamydomonas reinhardtii is a gene encoded triacylglyceride (TAG) and lipid (oil body) synthesis. The CrACCase gene was little studied and had not been genetically engineered either in-silico or in-vivo. In this study, we provide bioinformatic precision information for genome editing, especially in CrACCase. This study aimed to construct sgRNA and predict the functional region of the putative mutant protein of the CrACCase. Based on the results of molecular identification, the best CrACCase (GeneBank XM_001703135) can be genetically in-silico modified. The best potential sgRNA constructions in this study were GCGTCTGCTCAATCACACGGCGG, TTGAGGTCGGAACTCCAGCGG, and AGGCAATACCCTCAATTGGGTGG with efficiency values of 79.27, 68.25, and 65.17%, respectively. The best oligo sgRNA obtained has a protospacer adjacent motif (PAM) site with NGG especially in the form of CGG and TGG. The location of the engineered CrACCase gene mutation was found in the XM_001703135.1:1089 region in the Chlamydomonas reinhardtii genome, especially in the negative strand. CrACCase protein was predicted to have the structure of carboxyl transferase subunit of ACC, carboxyl transferase subunit of putative PCC, humanized carboxyltransferase domain of yeast Acetyl-CoA carboxylase, and Acetyl-CoA Carboxylase. Changes in frameshift mutations in the CrACCase gene influenced structural changes of the functional regions of the ligand-protein binding sites at residues D:C 92, 95, 111, and 114 where these sites are zinc ion binding sites. This structural change resulted in a change in the function of the CrACCase protein. This bioinformatics information is important to perform in-vivo genome editing on the CrACCase in the future so that mutants with the highest TAG production or the highest biodiesel (oil body) producer can be obtained. The manipulation of the CrACCase gene in Chlamydomonas reinhardtii can be applied to other microalgae organisms with the highest lipid percentages to increase future bioenergy production by molecular biologists and biotechnologists.
- Subjects
ACETYL-CoA carboxylase; CHLAMYDOMONAS reinhardtii; PROTEOMICS; MUTANT proteins; FRAMESHIFT mutation; MOLECULAR biologists; GENOME editing; ACETYLCOENZYME A
- Publication
Jordan Journal of Biological Sciences, 2022, Vol 15, Issue 3, p431
- ISSN
1995-6673
- Publication type
Article
- DOI
10.54319/jjbs/150312